##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R/site-library --no-vignettes --timings FLAMES_2.1.2.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’
* using R Under development (unstable) (2024-11-24 r87369)
* using platform: aarch64-unknown-linux-gnu
* R was compiled by
    gcc (conda-forge gcc 14.2.0-1) 14.2.0
    GNU Fortran (conda-forge gcc 14.2.0-1) 14.2.0
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.1.2’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 43 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (conda-forge gcc 14.2.0-1) 14.2.0’
* checking C++ specification ... OK
* checking installed package size ... INFO
  installed size is  5.2Mb
  sub-directories of 1Mb or more:
    data   2.7Mb
    libs   1.4Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
create_spe: no visible binding for global variable 'barcode'
filter_coverage: no visible global function definition for
  'starts_with'
filter_coverage: no visible binding for global variable 'filter_res'
find_barcode: no visible binding for global variable 'Sample'
find_barcode: no visible binding for global variable 'Outfile'
find_variants_grange: no visible binding for global variable
  'which_label'
find_variants_grange: no visible binding for global variable
  'nucleotide'
find_variants_grange: no visible binding for global variable 'pos'
find_variants_grange: no visible binding for global variable 'count'
find_variants_grange: no visible binding for global variable
  'counts_no_ins'
find_variants_grange: no visible binding for global variable 'ref'
generate_sc_sce: no visible binding for global variable 'FSM_match'
get_coverage: no visible binding for global variable 'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
  'pct'
plot_coverage: no visible binding for global variable 'tr_length'
plot_coverage: no visible binding for global variable 'read_counts'
plot_coverage: no visible binding for global variable 'total_counts'
plot_coverage: no visible binding for global variable 'cumpct'
plot_coverage: no visible binding for global variable 'length_bin'
plot_coverage: no visible binding for global variable 'min_length'
plot_coverage: no visible binding for global variable 'max_length'
plot_coverage: no visible global function definition for 'head'
plot_coverage: no visible binding for global variable 'transcript'
plot_demultiplex: no visible binding for global variable 'CellBarcode'
plot_demultiplex: no visible binding for global variable 'Sample'
plot_demultiplex: no visible binding for global variable 'UMI'
plot_demultiplex: no visible binding for global variable 'UMI_count'
plot_demultiplex: no visible binding for global variable 'barcode_rank'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n_reads'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_demultiplex: no visible binding for global variable 'total reads'
plot_demultiplex: no visible binding for global variable 'demultiplexed
  reads'
plot_demultiplex: no visible binding for global variable 'single match
  reads'
plot_demultiplex: no visible binding for global variable
  'undemultiplexted reads'
plot_demultiplex: no visible binding for global variable
  'multi-matching reads'
plot_demultiplex: no visible binding for global variable 'Type'
plot_demultiplex: no visible binding for global variable 'Reads'
plot_demultiplex: no visible binding for global variable 'input'
plot_demultiplex: no visible binding for global variable 'output'
plot_demultiplex: no visible binding for global variable
  'read1_with_adapter'
plot_demultiplex: no visible binding for global variable 'Count'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
plot_isoform_heatmap : group_annotation: no visible global function
  definition for 'HeatmapAnnotation'
plot_isoform_reduced_dim: no visible binding for global variable 'x'
plot_isoform_reduced_dim: no visible binding for global variable 'y'
plot_isoform_reduced_dim: no visible binding for global variable 'expr'
plot_spatial_isoform: no visible global function definition for 'head'
plot_spatial_pie: no visible global function definition for 'head'
plot_spatial_pie: no visible binding for global variable 'imageY'
plot_spatial_pie: no visible binding for global variable 'imageX'
relative_mutation_positions: no visible binding for global variable
  'region'
relative_mutation_positions_single: no visible binding for global
  variable 'type'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_mutations: no visible binding for global variable 'mutation_index'
sc_mutations: no visible binding for global variable 'bam_index'
variant_count_tb: no visible binding for global variable 'barcode'
variant_count_tb: no visible binding for global variable 'allele_count'
variant_count_tb: no visible binding for global variable
  'cell_total_reads'
Undefined global functions or variables:
  . BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
  HeatmapAnnotation Outfile Reads Sample Type UMI UMI_count
  allele_count bam_index barcode barcode_rank cell_id cell_total_reads
  cnt count counts_no_ins cumpct demultiplexed reads everything expr
  filter_res gene_id head imageX imageY input label length_bin
  max_length min_length multi-matching reads mutation_index n_reads
  name nucleotide output pct pos read1_with_adapter read_counts ref
  region single match reads starts_with total reads total_counts tr_id
  tr_length transcript type undemultiplexted reads value which_label x
  y
Consider adding
  importFrom("base", "match", "single")
  importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
  bulk_long_pipeline.Rd: SummarizedExperiment
  sc_long_multisample_pipeline.Rd: SingleCellExperiment
  sc_long_pipeline.Rd: SingleCellExperiment
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/libs/FLAMES.so’:
  Found ‘abort’, possibly from ‘abort’ (C)
  Found ‘exit’, possibly from ‘exit’ (C)
  Found ‘stderr’, possibly from ‘stderr’ (C)
  Found ‘stdout’, possibly from ‘stdout’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘FLAMES-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: bulk_long_pipeline
> ### Title: Pipeline for Bulk Data
> ### Aliases: bulk_long_pipeline
> 
> ### ** Examples
> 
> # download the two fastq files, move them to a folder to be merged together
> temp_path <- tempfile()
> bfc <- BiocFileCache::BiocFileCache(temp_path, ask = FALSE)
> file_url <-
+   "https://raw.githubusercontent.com/OliverVoogd/FLAMESData/master/data"
> # download the required fastq files, and move them to new folder
> fastq1 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq1", paste(file_url, "fastq/sample1.fastq.gz", sep = "/")))]]
> fastq2 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq2", paste(file_url, "fastq/sample2.fastq.gz", sep = "/")))]]
> annotation <- bfc[[names(BiocFileCache::bfcadd(bfc, "annot.gtf", paste(file_url, "SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf", sep = "/")))]]
> genome_fa <- bfc[[names(BiocFileCache::bfcadd(bfc, "genome.fa", paste(file_url, "SIRV_isoforms_multi-fasta_170612a.fasta", sep = "/")))]]
> fastq_dir <- paste(temp_path, "fastq_dir", sep = "/") # the downloaded fastq files need to be in a directory to be merged together
> dir.create(fastq_dir)
> file.copy(c(fastq1, fastq2), fastq_dir)
[1] TRUE TRUE
> unlink(c(fastq1, fastq2)) # the original files can be deleted
> 
> outdir <- tempfile()
> dir.create(outdir)
> se <- bulk_long_pipeline(
+   annotation = annotation, fastq = fastq_dir, outdir = outdir, genome_fa = genome_fa,
+   config_file = create_config(outdir, type = "sc_3end", threads = 1, no_flank = TRUE)
+ )
Writing configuration parameters to:  /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/config_file_3881453.json 
#### Input parameters:
{
  "pipeline_parameters": {
    "seed": [2022],
    "threads": [1],
    "do_barcode_demultiplex": [true],
    "do_gene_quantification": [true],
    "do_genome_alignment": [true],
    "do_isoform_identification": [true],
    "bambu_isoform_identification": [false],
    "multithread_isoform_identification": [false],
    "do_read_realignment": [true],
    "do_transcript_quantification": [true],
    "oarfish_quantification": [true]
  },
  "barcode_parameters": {
    "max_bc_editdistance": [2],
    "max_flank_editdistance": [8],
    "pattern": {
      "primer": ["CTACACGACGCTCTTCCGATCT"],
      "BC": ["NNNNNNNNNNNNNNNN"],
      "UMI": ["NNNNNNNNNNNN"],
      "polyT": ["TTTTTTTTT"]
    },
    "strand": ["-"],
    "TSO_seq": ["AAGCAGTGGTATCAACGCAGAGTACATGGG"],
    "TSO_prime": [5],
    "cutadapt_minimum_length": [10],
    "full_length_only": [false]
  },
  "isoform_parameters": {
    "generate_raw_isoform": [false],
    "max_dist": [10],
    "max_ts_dist": [100],
    "max_splice_match_dist": [10],
    "min_fl_exon_len": [40],
    "max_site_per_splice": [3],
    "min_sup_cnt": [5],
    "min_cnt_pct": [0.001],
    "min_sup_pct": [0.2],
    "bambu_trust_reference": [true],
    "strand_specific": [0],
    "remove_incomp_reads": [4],
    "downsample_ratio": [1]
  },
  "alignment_parameters": {
    "use_junctions": [true],
    "no_flank": [true]
  },
  "realign_parameters": {
    "use_annotation": [true]
  },
  "transcript_counting": {
    "min_tr_coverage": [0.4],
    "min_read_coverage": [0.4]
  }
} 
gene annotation: /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/3b39ed13877ab7_SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf 
genome fasta: /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/3b39ed1c6da29f_SIRV_isoforms_multi-fasta_170612a.fasta 
input fastq files: /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/fastq_dir/3b39ed1cd1203f_sample2.fastq.gz
 /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/fastq_dir/3b39ed589d54b2_sample1.fastq.gz
output directory: /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7 
minimap2 path: 
k8 path: 
#### Aligning reads to genome using minimap2
	Aligning sample  3b39ed1cd1203f_sample2 ...
05:57:31 Mon Dec 09 2024 minimap2_align
[M::mm_idx_gen::0.015*1.10] collected minimizers
[M::mm_idx_gen::0.026*1.06] sorted minimizers
[M::main::0.026*1.06] loaded/built the index for 7 target sequence(s)
[M::mm_mapopt_update::0.029*1.05] mid_occ = 14
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 7
[M::mm_idx_stat::0.031*1.05] distinct minimizers: 39103 (61.08% are singletons); average occurrences: 1.935; average spacing: 2.947
[M::worker_pipeline::8.856*0.99] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 -ax splice -t 1 -k14 --secondary=no --seed 2022 --splice-flank=no --junc-bed /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/tmp_splice_anno.bed12 --junc-bonus 1 /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/3b39ed1c6da29f_SIRV_isoforms_multi-fasta_170612a.fasta /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/fastq_dir/3b39ed1cd1203f_sample2.fastq.gz
[M::main] Real time: 8.862 sec; CPU: 8.766 sec; Peak RSS: 0.096 GB
	Aligning sample  3b39ed589d54b2_sample1 ...
05:57:41 Mon Dec 09 2024 minimap2_align
[M::mm_idx_gen::0.015*1.10] collected minimizers
[M::mm_idx_gen::0.025*1.05] sorted minimizers
[M::main::0.025*1.05] loaded/built the index for 7 target sequence(s)
[M::mm_mapopt_update::0.028*1.05] mid_occ = 14
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 7
[M::mm_idx_stat::0.030*1.05] distinct minimizers: 39103 (61.08% are singletons); average occurrences: 1.935; average spacing: 2.947
[M::worker_pipeline::8.771*0.99] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 -ax splice -t 1 -k14 --secondary=no --seed 2022 --splice-flank=no --junc-bed /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/tmp_splice_anno.bed12 --junc-bonus 1 /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/3b39ed1c6da29f_SIRV_isoforms_multi-fasta_170612a.fasta /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/fastq_dir/3b39ed589d54b2_sample1.fastq.gz
[M::main] Real time: 8.778 sec; CPU: 8.663 sec; Peak RSS: 0.081 GB
05:57:50 Mon Dec 09 2024 find_isoform
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter({'duplicated_transcripts': 2})
#### find isoforms
SIRV1
SIRV2
SIRV3
SIRV4
SIRV5
SIRV6
SIRV7
#### Realign to transcript using minimap2
	Realigning sample  3b39ed1cd1203f_sample2 ...
05:57:52 Mon Dec 09 2024 minimap2_realign
[M::mm_idx_gen::0.004*1.44] collected minimizers
[M::mm_idx_gen::0.007*2.02] sorted minimizers
[M::main::0.007*2.01] loaded/built the index for 74 target sequence(s)
[M::mm_mapopt_update::0.008*1.93] mid_occ = 16
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 74
[M::mm_idx_stat::0.008*1.89] distinct minimizers: 4777 (33.26% are singletons); average occurrences: 3.018; average spacing: 5.390
[M::worker_pipeline::0.889*2.50] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 --eqx -N 100 -ax map-ont /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/transcript_assembly.fa /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/fastq_dir/3b39ed1cd1203f_sample2.fastq.gz
[M::main] Real time: 0.892 sec; CPU: 2.224 sec; Peak RSS: 0.022 GB
file renamed to  3b39ed1cd1203f_sample2_realign2transcript.bam 
Warning in file.remove(file.path(outdir, paste0(prefix, "tmp_align.bam"))) :
  cannot remove file '/home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/3b39ed1cd1203f_sample2_tmp_align.bam', reason 'No such file or directory'
	Realigning sample  3b39ed589d54b2_sample1 ...
05:57:53 Mon Dec 09 2024 minimap2_realign
[M::mm_idx_gen::0.004*1.47] collected minimizers
[M::mm_idx_gen::0.007*2.02] sorted minimizers
[M::main::0.007*2.01] loaded/built the index for 74 target sequence(s)
[M::mm_mapopt_update::0.008*1.93] mid_occ = 16
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 74
[M::mm_idx_stat::0.008*1.88] distinct minimizers: 4777 (33.26% are singletons); average occurrences: 3.018; average spacing: 5.390
[M::worker_pipeline::1.209*2.53] mapped 2500 sequences
[M::main] Version: 2.17-r941
[M::main] CMD: /usr/bin/minimap2 --eqx -N 100 -ax map-ont /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/transcript_assembly.fa /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed1ee5fae/fastq_dir/3b39ed589d54b2_sample1.fastq.gz
[M::main] Real time: 1.211 sec; CPU: 3.057 sec; Peak RSS: 0.025 GB
file renamed to  3b39ed589d54b2_sample1_realign2transcript.bam 
Warning in file.remove(file.path(outdir, paste0(prefix, "tmp_align.bam"))) :
  cannot remove file '/home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/3b39ed589d54b2_sample1_tmp_align.bam', reason 'No such file or directory'
#### Generating transcript count matrix
2024-12-09T05:57:55.249781Z  INFO oarfish: setting user-provided filter parameters.
2024-12-09T05:57:55.252161Z  INFO oarfish::alignment_parser: read header from BAM file /home/biocbuild/tmp/RtmpMsiQ3B/file3b39ed7604f9b7/3b39ed1cd1203f_sample2_realign2transcript.bam, contains 74 reference sequences.
thread 'main' panicked at src/alignment_parser.rs:29:10:
has inner header
note: run with `RUST_BACKTRACE=1` environment variable to display a backtrace
Error in run_oarfish(realign_bam, outdir, threads = config$pipeline_parameters$threads,  : 
  error running oarfish:
134
Calls: bulk_long_pipeline ... quantify_transcript -> quantify_transcript_oarfish -> run_oarfish
Execution halted
Examples with CPU (user + system) or elapsed time > 5s
      user system elapsed
blaze 0.52  0.105  16.973
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 4 NOTEs
See
  ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (conda-forge gcc 14.2.0-1) 14.2.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c RcppFunctions.cpp -o RcppFunctions.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c classes/BamRecord.cpp -o classes/BamRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c classes/GFFRecord.cpp -o classes/GFFRecord.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c classes/Isoforms.cpp -o classes/Isoforms.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c classes/junctions.cpp -o classes/junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c tests/test-junctions.cpp -o tests/test-junctions.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c tests/test-parsing.cpp -o tests/test-parsing.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c utility/cigars.cpp -o utility/cigars.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -DR_NO_REMAP -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
gcc -I"/home/biocbuild/R/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/testthat/include' -I/usr/local/include    -fPIC  -g -O2  -c utility/bam.c -o utility/bam.o
g++ -std=gnu++17 -shared -L/home/biocbuild/R/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/R/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

R Under development (unstable) (2024-11-24 r87369) -- "Unsuffered Consequences"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /home/biocbuild/tmp/RtmpQV0qOL/file3b4d141f2c218d/config_file_3886356.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQV0qOL/file3b4d145351ef28/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQV0qOL/file3b4d147919e27f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQV0qOL/file3b4d147919e27f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d147e30b262/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d147e30b262/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d147e30b262/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d147e30b262/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQV0qOL/file3b4d1446560eb/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQV0qOL/file3b4d1446560eb/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d145d9e0140/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d145d9e0140/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d145d9e0140/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /home/biocbuild/tmp/RtmpQV0qOL/file3b4d145d9e0140/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQV0qOL/file3b4d1446560eb/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmpQV0qOL/file3b4d147958027d/bc_allow.tsv
Number of known barcodes: 143
Processing file: /home/biocbuild/R/R-4.5.0-devel_2024-11-24/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
> 
> proc.time()
   user  system elapsed 
 29.105   1.938  31.325