CHECK report for affxparser on malbec2
This page was generated on 2019-10-16 11:55:49 -0400 (Wed, 16 Oct 2019).
affxparser 1.56.0
Kasper Daniel Hansen
| Snapshot Date: 2019-10-15 17:01:26 -0400 (Tue, 15 Oct 2019) |
| URL: https://git.bioconductor.org/packages/affxparser |
| Branch: RELEASE_3_9 |
| Last Commit: 20d2770 |
| Last Changed Date: 2019-05-02 11:53:04 -0400 (Thu, 02 May 2019) |
| malbec2 | Linux (Ubuntu 18.04.2 LTS) / x86_64 | OK | OK | [ WARNINGS ] | |  |
| tokay2 | Windows Server 2012 R2 Standard / x64 | OK | OK | OK | OK | |
| celaya2 | OS X 10.11.6 El Capitan / x86_64 | OK | OK | WARNINGS | OK | |
Summary
Command output
Installation output
affxparser.Rcheck/00install.out
Tests output
affxparser.Rcheck/tests/convertCel.Rout
R version 3.6.1 (2019-07-05) -- "Action of the Toes"
Copyright (C) 2019 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ ## rawData/
+ pathR <- system.file(package="AffymetrixDataTestFiles", mustWork=TRUE)
+ pathR <- file.path(pathR, "rawData")
+
+ ## File #1: Test3
+ chipType <- "Test3"
+ path <- file.path(pathR, "FusionSDK_Test3", chipType, "2.Calvin")
+ filename <- list.files(path=path, pattern="[.]CEL$")[1]
+ pathname <- file.path(path, filename)
+ hdr <- readCelHeader(pathname)
+ str(hdr)
+ stopifnot(hdr$chiptype == chipType)
+ filename4 <- gsub(".CEL", ",v4.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == hdr$chiptype)
+
+ ## New chip type
+ newChipType <- sprintf("%s-custom", chipType)
+ filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ ## FIXME
+ ## stopifnot(hdr4$chiptype == newChipType)
+
+
+ ## File #2: FusionSDK_HG-U133A
+ chipType <- "HG-U133A"
+ path <- file.path(pathR, "FusionSDK_HG-U133A", chipType, "2.Calvin")
+ filename <- list.files(path=path, pattern="[.]CEL$")[1]
+ pathname <- file.path(path, filename)
+ hdr <- readCelHeader(pathname)
+ str(hdr)
+ stopifnot(hdr$chiptype == chipType)
+ filename4 <- gsub(".CEL", ",v4.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == hdr$chiptype)
+
+ ## New chip type
+ newChipType <- sprintf("%s-custom", chipType)
+ filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == newChipType)
+
+
+ ## File #3: FusionSDK_Focus
+ chipType <- "HG-Focus"
+ path <- file.path(pathR, "FusionSDK_HG-Focus", chipType, "2.Calvin")
+ filename <- list.files(path=path, pattern="[.]CEL$")[1]
+ pathname <- file.path(path, filename)
+ hdr <- readCelHeader(pathname)
+ str(hdr)
+ stopifnot(hdr$chiptype == chipType)
+ filename4 <- gsub(".CEL", ",v4.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == hdr$chiptype)
+
+ ## New chip type
+ newChipType <- sprintf("%s-custom", chipType)
+ filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ ## FIXME
+ ## stopifnot(hdr4$chiptype == newChipType)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 14
$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL"
$ version : int 1
$ cols : int 126
$ rows : int 126
$ total : int 15876
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
$ chiptype : chr "Test3"
$ header : chr ""
$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 5
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
CEL 1: /home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL
CEL 2: ./Test3-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
Comparing CEL headers...
Comparing CEL headers...done
Comparing CEL data...
Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./Test3-1-121502,v4.CEL"
List of 14
$ filename : chr "./Test3-1-121502,v4.CEL"
$ version : int 4
$ cols : int 126
$ rows : int 126
$ total : int 15876
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
$ chiptype : chr "Test3"
$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 5
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'Test3' to 'Test3-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./Test3-1-121502,v4,custom.CEL"
List of 14
$ filename : chr "./Test3-1-121502,v4,custom.CEL"
$ version : int 4
$ cols : int 126
$ rows : int 126
$ total : int 15876
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
$ chiptype : chr "Test3"
$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 5
$ nmasked : int 0
List of 14
$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-U133A/HG-U133A/2.Calvin/ethan1-1.CEL"
$ version : int 4
$ cols : int 712
$ rows : int 712
$ total : int 506944
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
$ chiptype : chr "HG-U133A"
$ header : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
$ datheader : chr "[46..48458] ethan1-1:CLS=5377 RWS=5377 XIN=2 YIN=2 VE=30 2.0 11/10/04 18:23:42 M10SIM M10 \024 \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 2085
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
CEL 1: /home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-U133A/HG-U133A/2.Calvin/ethan1-1.CEL
CEL 2: ./ethan1-1,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
Comparing CEL headers...
Comparing CEL headers...done
Comparing CEL data...
Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./ethan1-1,v4.CEL"
List of 14
$ filename : chr "./ethan1-1,v4.CEL"
$ version : int 4
$ cols : int 712
$ rows : int 712
$ total : int 506944
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
$ chiptype : chr "HG-U133A"
$ header : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
$ datheader : chr "[46..48458] ethan1-1:CLS=5377 RWS=5377 XIN=2 YIN=2 VE=30 2.0 11/10/04 18:23:42 M10SIM M10 \024 \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 2085
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-U133A' to 'HG-U133A-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./ethan1-1,v4,custom.CEL"
List of 14
$ filename : chr "./ethan1-1,v4,custom.CEL"
$ version : int 4
$ cols : int 712
$ rows : int 712
$ total : int 506944
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
$ chiptype : chr "HG-U133A-custom"
$ header : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
$ datheader : chr "[46..48458] ethan1-1:CLS=5377 RWS=5377 XIN=2 YIN=2 VE=30 2.0 11/10/04 18:23:42 M10SIM M10 \024 \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 2085
$ nmasked : int 0
List of 14
$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-Focus/HG-Focus/2.Calvin/HG-"| __truncated__
$ version : int 1
$ cols : int 448
$ rows : int 448
$ total : int 200704
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
$ chiptype : chr "HG-Focus"
$ header : chr ""
$ datheader : chr "[7..46138] B1:CLS=2920 RWS=2920 XIN=3 YIN=3 VE=17 2.0 05/15/02 11:07:10 \024 \024 HG-Focus.1sq \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 508
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
CEL 1: /home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-Focus/HG-Focus/2.Calvin/HG-Focus-1-121502.CEL
CEL 2: ./HG-Focus-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
Comparing CEL headers...
Comparing CEL headers...done
Comparing CEL data...
Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./HG-Focus-1-121502,v4.CEL"
List of 14
$ filename : chr "./HG-Focus-1-121502,v4.CEL"
$ version : int 4
$ cols : int 448
$ rows : int 448
$ total : int 200704
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
$ chiptype : chr "HG-Focus"
$ header : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
$ datheader : chr "[7..46138] B1:CLS=2920 RWS=2920 XIN=3 YIN=3 VE=17 2.0 05/15/02 11:07:10 \024 \024 HG-Focus.1sq \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 508
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-Focus' to 'HG-Focus-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./HG-Focus-1-121502,v4,custom.CEL"
List of 14
$ filename : chr "./HG-Focus-1-121502,v4,custom.CEL"
$ version : int 4
$ cols : int 448
$ rows : int 448
$ total : int 200704
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
$ chiptype : chr "HG-Focus"
$ header : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
$ datheader : chr "[7..46138] B1:CLS=2920 RWS=2920 XIN=3 YIN=3 VE=17 2.0 05/15/02 11:07:10 \024 \024 HG-Focus.1sq \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 508
$ nmasked : int 0
>
> proc.time()
user system elapsed
3.473 0.132 3.712
affxparser.Rcheck/tests/readCdfDataFrame.Rout
affxparser.Rcheck/tests/readCdfQc.Rout
affxparser.Rcheck/tests/readCdfUnits_etal.Rout
R version 3.6.1 (2019-07-05) -- "Action of the Toes"
Copyright (C) 2019 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+
+ # Read CDF structure
+ cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+ hdr <- readCdfHeader(cdf)
+ Jall <- hdr$nunits
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ fcnNames <- c(
+ "readCdf",
+ "readCdfUnits",
+ "readCdfUnitNames",
+ "readCdfNbrOfCellsPerUnitGroup",
+ "readCdfGroupNames",
+ "readCdfCellIndices",
+ "readCdfIsPm"
+ )
+
+ # Read full file
+ for (fcnName in fcnNames) {
+ fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+ data <- fcn(cdf)
+ str(head(data))
+ stopifnot(length(data) == Jall)
+ } # for (fcn ...)
+
+ for (fcnName in fcnNames) {
+ fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing %s() with '%s' indices...", fcnName, name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCdfQc(cdf, units=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- fcn(cdf, units=idxs)
+ str(head(data))
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data) == J)
+ }
+ message(sprintf("Testing %s() with '%s' indices...done", fcnName, name))
+ } # for (ii ...)
+ } # for (fcn ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
$ Pae_16SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1000
$ Pae_23SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1001
$ PA1178_oprH_at :List of 7
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 9
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1002
$ PA1816_dnaQ_at :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 9
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1003
$ PA3183_zwf_at :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 9
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1004
$ PA3640_dnaE_at :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 9
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1005
List of 6
$ Pae_16SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ Pae_23SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1178_oprH_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 6
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1816_dnaQ_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 6
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3183_zwf_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 6
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3640_dnaE_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 6
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
List of 6
$ Pae_16SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
$ Pae_23SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
$ PA1178_oprH_at : Named int 24
..- attr(*, "names")= chr "PA1178_oprH_at"
$ PA1816_dnaQ_at : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_at"
$ PA3183_zwf_at : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_at"
$ PA3640_dnaE_at : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_at"
List of 6
$ Pae_16SrRNA_s_at: chr ""
$ Pae_23SrRNA_s_at: chr ""
$ PA1178_oprH_at : chr ""
$ PA1816_dnaQ_at : chr ""
$ PA3183_zwf_at : chr ""
$ PA3640_dnaE_at : chr ""
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_16SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
$ Pae_23SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_23SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
$ PA1178_oprH_at :List of 1
..$ groups:List of 1
.. ..$ PA1178_oprH_at:List of 1
.. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
$ PA1816_dnaQ_at :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_at:List of 1
.. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
$ PA3183_zwf_at :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_at:List of 1
.. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
$ PA3640_dnaE_at :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_at:List of 1
.. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdf() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1000
$ Pae_23SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1001
$ PA1178_oprH_at :List of 7
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 9
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1002
$ PA1816_dnaQ_at :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 9
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1003
$ PA3183_zwf_at :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 9
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1004
$ PA3640_dnaE_at :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 9
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1005
Testing readCdf() with 'readAll' indices...done
Testing readCdf() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 7
..$ groups :List of 1
.. ..$ PA1178_oprH_st:List of 9
.. .. ..$ x : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
.. .. ..$ y : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "c" "g" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "g" "g" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1052
Testing readCdf() with 'readOne' indices...done
Testing readCdf() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 9
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1053
$ PA3183_zwf_st :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 9
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1054
$ PA3640_dnaE_st :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 9
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1055
$ PA4407_ftsZ_st :List of 7
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 9
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1056
$ AFFX-Athal-Actin_5_r_at:List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 9
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1100
$ AFFX-Athal-Actin_M_at :List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 9
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1101
Testing readCdf() with 'readSome' indices...done
Testing readCdf() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 9
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1053
$ PA3183_zwf_st :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 9
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1054
$ PA3640_dnaE_st :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 9
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1055
$ PA4407_ftsZ_st :List of 7
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 9
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1056
$ AFFX-Athal-Actin_5_r_at:List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 9
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1100
$ AFFX-Athal-Actin_M_at :List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 9
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1101
Testing readCdf() with 'readDouble' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdfUnits() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ Pae_23SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1178_oprH_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 6
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1816_dnaQ_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 6
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3183_zwf_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 6
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3640_dnaE_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 6
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
Testing readCdfUnits() with 'readAll' indices...done
Testing readCdfUnits() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA1178_oprH_st:List of 6
.. .. ..$ x : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
.. .. ..$ y : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "c" "g" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "g" "g" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
Testing readCdfUnits() with 'readOne' indices...done
Testing readCdfUnits() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 6
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3183_zwf_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 6
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3640_dnaE_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 6
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA4407_ftsZ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 6
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ AFFX-Athal-Actin_5_r_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 6
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ AFFX-Athal-Actin_M_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 6
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
Testing readCdfUnits() with 'readSome' indices...done
Testing readCdfUnits() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 6
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3183_zwf_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 6
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3640_dnaE_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 6
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA4407_ftsZ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 6
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ AFFX-Athal-Actin_5_r_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 6
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ AFFX-Athal-Actin_M_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 6
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
Testing readCdfUnits() with 'readDouble' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'readAll' indices...
List of 1
$ idxs: NULL
chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
Testing readCdfUnitNames() with 'readAll' indices...done
Testing readCdfUnitNames() with 'readOne' indices...
List of 1
$ idxs: int 10
chr "PA1178_oprH_st"
Testing readCdfUnitNames() with 'readOne' indices...done
Testing readCdfUnitNames() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readSome' indices...done
Testing readCdfUnitNames() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readDouble' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
$ Pae_23SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
$ PA1178_oprH_at : Named int 24
..- attr(*, "names")= chr "PA1178_oprH_at"
$ PA1816_dnaQ_at : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_at"
$ PA3183_zwf_at : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_at"
$ PA3640_dnaE_at : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st: Named int 24
..- attr(*, "names")= chr "PA1178_oprH_st"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_st"
$ PA3183_zwf_st : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_st"
$ PA3640_dnaE_st : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_st"
$ PA4407_ftsZ_st : Named int 24
..- attr(*, "names")= chr "PA4407_ftsZ_st"
$ AFFX-Athal-Actin_5_r_at: Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
$ AFFX-Athal-Actin_M_at : Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_st"
$ PA3183_zwf_st : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_st"
$ PA3640_dnaE_st : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_st"
$ PA4407_ftsZ_st : Named int 24
..- attr(*, "names")= chr "PA4407_ftsZ_st"
$ AFFX-Athal-Actin_5_r_at: Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
$ AFFX-Athal-Actin_M_at : Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at: chr ""
$ Pae_23SrRNA_s_at: chr ""
$ PA1178_oprH_at : chr ""
$ PA1816_dnaQ_at : chr ""
$ PA3183_zwf_at : chr ""
$ PA3640_dnaE_at : chr ""
Testing readCdfGroupNames() with 'readAll' indices...done
Testing readCdfGroupNames() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st: chr ""
Testing readCdfGroupNames() with 'readOne' indices...done
Testing readCdfGroupNames() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : chr ""
$ PA3183_zwf_st : chr ""
$ PA3640_dnaE_st : chr ""
$ PA4407_ftsZ_st : chr ""
$ AFFX-Athal-Actin_5_r_at: chr ""
$ AFFX-Athal-Actin_M_at : chr ""
Testing readCdfGroupNames() with 'readSome' indices...done
Testing readCdfGroupNames() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : chr ""
$ PA3183_zwf_st : chr ""
$ PA3640_dnaE_st : chr ""
$ PA4407_ftsZ_st : chr ""
$ AFFX-Athal-Actin_5_r_at: chr ""
$ AFFX-Athal-Actin_M_at : chr ""
Testing readCdfGroupNames() with 'readDouble' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_16SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
$ Pae_23SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_23SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
$ PA1178_oprH_at :List of 1
..$ groups:List of 1
.. ..$ PA1178_oprH_at:List of 1
.. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
$ PA1816_dnaQ_at :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_at:List of 1
.. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
$ PA3183_zwf_at :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_at:List of 1
.. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
$ PA3640_dnaE_at :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_at:List of 1
.. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
Testing readCdfCellIndices() with 'readAll' indices...done
Testing readCdfCellIndices() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 1
..$ groups:List of 1
.. ..$ PA1178_oprH_st:List of 1
.. .. ..$ indices: int [1:24] 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
Testing readCdfCellIndices() with 'readOne' indices...done
Testing readCdfCellIndices() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_st:List of 1
.. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
$ PA3183_zwf_st :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_st:List of 1
.. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
$ PA3640_dnaE_st :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_st:List of 1
.. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
$ PA4407_ftsZ_st :List of 1
..$ groups:List of 1
.. ..$ PA4407_ftsZ_st:List of 1
.. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 1
.. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 1
.. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readSome' indices...done
Testing readCdfCellIndices() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_st:List of 1
.. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
$ PA3183_zwf_st :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_st:List of 1
.. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
$ PA3640_dnaE_st :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_st:List of 1
.. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
$ PA4407_ftsZ_st :List of 1
..$ groups:List of 1
.. ..$ PA4407_ftsZ_st:List of 1
.. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 1
.. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 1
.. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readDouble' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readAll' indices...done
Testing readCdfIsPm() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 1
..$ PA1178_oprH_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readOne' indices...done
Testing readCdfIsPm() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readSome' indices...done
Testing readCdfIsPm() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readDouble' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
1.138 0.046 1.169
affxparser.Rcheck/tests/readCdfUnitsWriteMap.Rout
affxparser.Rcheck/tests/readCel.Rout
R version 3.6.1 (2019-07-05) -- "Action of the Toes"
Copyright (C) 2019 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+
+ # Find all CEL files
+ cels <- list.files(path=pathD, pattern="[.]CEL$",
+ recursive=TRUE, full.names=TRUE)
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ # readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ for (kk in seq_along(cels)) {
+ cel <- cels[kk]
+
+ # Read full file
+ data <- readCel(cel)
+ str(data)
+ Jall <- data$header$total
+ stopifnot(length(data$intensities) == Jall)
+
+ # Read different subsets of cells
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCel() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCel(cel, indices=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCel(cel, indices=idxs)
+ str(data)
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data$intensities) == J)
+ }
+ message(sprintf("Testing readCel() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # for (kk ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num 143
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num 136
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-1-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-1-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-1-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num 143
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-1-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-1-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-2-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-2-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-2-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num 136
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-2-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/3.ASCII/Test3-2-121502.CEL"
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
1.543 0.067 1.674
affxparser.Rcheck/tests/readCelIntensities.Rout
R version 3.6.1 (2019-07-05) -- "Action of the Toes"
Copyright (C) 2019 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+
+ # Find all CEL files
+ path <- file.path(pathD, "2.Calvin")
+ cels <- list.files(path=path, pattern="[.]CEL$", full.names=TRUE)
+
+ hdr <- readCelHeader(cels[1L])
+ I <- length(cels)
+ Jall <- hdr$total
+
+ # Read full file
+ data <- readCelIntensities(cels)
+ str(data)
+ stopifnot(all(dim(data) == c(Jall,I)))
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ # readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ # Read different subsets of cells
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCelIntensities() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCelIntensities(cels, indices=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCelIntensities(cels, indices=idxs)
+ str(data)
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(all(dim(data) == c(J,I)))
+ }
+ message(sprintf("Testing readCelIntensities() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
num [1:15876, 1:2] 190 11263 164 11272 181 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL" "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
Testing readCelIntensities() with 'readAll' indices...
List of 1
$ idxs: NULL
num [1:15876, 1:2] 190 11263 164 11272 181 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL" "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
Testing readCelIntensities() with 'readAll' indices...done
Testing readCelIntensities() with 'readOne' indices...
List of 1
$ idxs: int 10
num [1, 1:2] 143 136
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL" "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
Testing readCelIntensities() with 'readOne' indices...done
Testing readCelIntensities() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
num [1:10, 1:2] 11053 161 11466 152 11210 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL" "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
Testing readCelIntensities() with 'readSome' indices...done
Testing readCelIntensities() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
num [1:10, 1:2] 11053 161 11466 152 11210 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL" "/home/biocbuild/bbs-3.9-bioc/R/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-2-121502.CEL"
Testing readCelIntensities() with 'readDouble' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE, readHeader = FALSE, readStdvs = | __truncated__ ...
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE, readHeader = FALSE, readStdvs = | __truncated__ ...
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE, readHeader = FALSE, readStdvs = | __truncated__ ...
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.472 0.048 0.505
affxparser.Rcheck/tests/readCelRectangle.Rout
affxparser.Rcheck/tests/readCelUnits.Rout
R version 3.6.1 (2019-07-05) -- "Action of the Toes"
Copyright (C) 2019 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+
+ # Read CDF structure
+ cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+ hdr <- readCdfHeader(cdf)
+ Jall <- hdr$nunits
+
+ # Find all CEL files
+ cels <- list.files(path=pathD, pattern="[.]CEL$",
+ recursive=TRUE, full.names=TRUE)
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ # Read full file
+ data <- readCelUnits(cels, cdf=cdf)
+ str(head(data))
+ stopifnot(length(data) == Jall)
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCelUnits() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCelUnits(cels, units=idxs, cdf=cdf), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCelUnits(cels, units=idxs, cdf=cdf)
+ str(head(data))
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data) == J)
+ }
+ message(sprintf("Testing readCelUnits() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...done
Testing readCelUnits() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 1
..$ PA1178_oprH_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 114 119 142 139 170 ...
Testing readCelUnits() with 'readOne' indices...done
Testing readCelUnits() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readSome' indices...done
Testing readCelUnits() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readDouble' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains non-positive indices."
$ call : language readCelUnits(cels, units = idxs, cdf = cdf)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains non-positive indices."
$ call : language readCelUnits(cels, units = idxs, cdf = cdf)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range: 1000000000"
$ call : language readCdfCellIndices(cdfFile, units = units, stratifyBy = stratifyBy, verbose = FALSE)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.754 0.059 0.797
affxparser.Rcheck/tests/readPgf.Rout
R version 3.6.1 (2019-07-05) -- "Action of the Toes"
Copyright (C) 2019 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles") && packageVersion("AffymetrixDataTestFiles") >= "0.4.0") {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "HuGene-1_0-st-v1")
+
+ # Read PGF structure
+ pgf <- file.path(pathA, "HuGene-1_0-st-v1.r4,10_probesets.pgf")
+
+ # NOTE: Hard-coded
+ Jall <- 10L
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=5L,
+ readSome=1:5,
+ readDouble=as.double(1:5),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ data <- readPgf(pgf)
+ str(head(data))
+ stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+ stopifnot(length(data$probesetName) == Jall)
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readPgf() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readPgf(pgf, indices=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readPgf(pgf, indices=idxs)
+ str(head(data))
+ stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data$probesetName) == J)
+ }
+ message(sprintf("Testing readPgf() with '%s' indices...done", name))
+ } # for (ii ...)
+
+
+ # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+ # Validate correctness of subsets
+ # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+ subsetPgf <- function(data, indices=NULL, ...) {
+ if (is.null(indices)) return(data)
+
+ # Atoms
+ offsets <- data$probesetStartAtom
+ natoms <- diff(c(offsets, length(data0$atomStartProbe)+1L))
+ offsets <- offsets[indices]
+ natoms <- natoms[indices]
+ # Identify atoms to keep
+ keep <- logical(length(data$atomStartProbe))
+ for (kk in seq_along(offsets)) {
+ keep[seq(from=offsets[kk], by=1L, length=natoms[kk])] <- TRUE;
+ }
+
+ for (ff in c("probeSequence", "probeId", "probeGcCount", "atomExonPosition", "atomId", "probeInterrogationPosition", "probeLength", "probeType")) {
+ data[[ff]] <- data[[ff]][keep]
+ }
+
+ data$atomStartProbe <- seq_len(sum(natoms))
+ data$probesetStartAtom <- c(1L, cumsum(natoms))[length(indices)]
+
+ # Probesets
+ for (ff in c("probesetName", "probesetId", "probesetType")) {
+ data[[ff]] <- data[[ff]][indices]
+ }
+
+ data
+ } # subsetPgf()
+
+ data0 <- readPgf(pgf)
+ Jall <- length(data0$probesetId)
+
+ for (kk in 1:10) {
+ n <- sample(Jall, size=1L)
+ idxs <- sort(sample(1:Jall, size=n, replace=FALSE))
+ data <- readPgf(pgf, indices=idxs)
+ dataS <- subsetPgf(data0, indices=idxs)
+ for (ff in c("probesetStartAtom", "atomExonPosition"))
+ data[[ff]] <- dataS[[ff]] <- NULL
+ stopifnot(all.equal(data, dataS))
+ }
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
$ probeSequence : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:10] "" "" "" "" ...
$ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
$ probeId : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
$ probesetType : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ probeSequence : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:10] "" "" "" "" ...
$ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
$ probeId : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
$ probesetType : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...done
Testing readPgf() with 'readOne' indices...
List of 1
$ idxs: int 5
List of 6
$ probeSequence : chr [1:4] "AGATGTGTATAGAGGGTTTAACTTA" "TGTGTATAGAGGGTTTAACTTAAAT" "GTGTATAGAGGGTTTAACTTAAATA" "GATGTGTATAGAGGGTTTAACTTAA"
$ probesetName : chr ""
$ probesetStartAtom: int 1
$ probeId : int [1:4] 611456 834021 857576 980218
$ probesetId : int 7892505
$ probesetType : chr "normgene->intron"
Testing readPgf() with 'readOne' indices...done
Testing readPgf() with 'readSome' indices...
List of 1
$ idxs: int [1:5] 1 2 3 4 5
List of 6
$ probeSequence : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:5] "" "" "" "" ...
$ probesetStartAtom: int [1:5] 1 5 9 13 17
$ probeId : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:5] 7892501 7892502 7892503 7892504 7892505
$ probesetType : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readSome' indices...done
Testing readPgf() with 'readDouble' indices...
List of 1
$ idxs: num [1:5] 1 2 3 4 5
List of 6
$ probeSequence : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:5] "" "" "" "" ...
$ probesetStartAtom: int [1:5] 1 5 9 13 17
$ probeId : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:5] 7892501 7892502 7892503 7892504 7892505
$ probesetType : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readDouble' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' contains a non-positive element"
$ call : language readPgfEnv(file, readBody = TRUE, indices = indices)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' contains a non-positive element"
$ call : language readPgfEnv(file, readBody = TRUE, indices = indices)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' contains an element out of range [1,10]: 1000000000"
$ call : language readPgfEnv(file, readBody = TRUE, indices = indices)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.501 0.050 0.561
affxparser.Rcheck/tests/testWriteAndReadEmptyCdf.Rout
affxparser.Rcheck/tests/testWriteAndReadEmptyCel.Rout
Example timings
affxparser.Rcheck/affxparser-Ex.timings